Pedido rápido

Ratón Prostasin/PRSS8 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PRSS8 Información de producto de clon de cDNA
Tamaño de cDNA:1020bp
Descripción de cDNA:Full length Clone DNA of Mus musculus protease, serine, 8 (prostasin) with N terminal His tag.
Sinónimo de gen:CAP1, mCAP1, C79772, AI313909, 2410039E18Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Prostasin/PRSS8 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.