Protein C cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Protein C cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1383 bp
Description
Full length Clone DNA of Mouse protein C.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Protein C cDNA ORF Clone, Mouse, untagged: Alternative Names

PC cDNA ORF Clone, Mouse; PROC cDNA ORF Clone, Mouse

Protein C Background Information

PROC (protein C gene) is a 62-kDa vitamin K-dependent plasma zymogen which, after activation to serine protease, plays an important role in the physiologic regulation of blood coagulation. Originally thought to be synthesized exclusively by the liver, recent reports have shown that PROC is also produced by many other cells including pancreatic islet β cells. Protein C a vitamin K-dependent plasma glycoprotein and is one of the body’s natural anticoagulants circulating at 7 nmol/L as an inactive protease zymogen.
Full Name
protein C, inactivator of coagulation factors Va and VIIIa
Add to Cart Successfully Add to Cart Failed