Pedido rápido

Text Size:AAA

Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse RAB28 Información de producto de clon de cDNA
Tamaño de cDNA:666 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus RAB28, member RAS oncogene family
Sinónimo de gen:2700023P08Rik,AW496496
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52290-ACG$225
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52290-ACR$225
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52290-ANG$225
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52290-ANR$225
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52290-CF$75
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52290-CH$195
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52290-CM$195
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52290-CY$195
Mouse RAB28 Gene cDNA clone plasmidMG52290-G$75
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52290-NF$195
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52290-NH$195
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52290-NM$195
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52290-NY$195
Ratón RAB28 clonación del ADN o clonación génica(Vector de expresión)MG52290-U$75
Ratón RAB28 clonación del ADN o clonación génica(vector de clonación)MG52290-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52290-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.