RPL36AL cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

RPL36AL cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
321 bp
Description
Full length Clone DNA of Mouse ribosomal protein L36A-like with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RPL36AL cDNA ORF Clone, Mouse, N-His tag: Alternative Names

2410038A03Rik cDNA ORF Clone, Mouse; RPL36A cDNA ORF Clone, Mouse

RPL36AL Background Information

Full Name
ribosomal protein L36a-like
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait