RPL4 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51706-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RPL4 Reagents

CRO Services

Product recommended


All RPL4 Reagents

RPL4 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Mouse ribosomal protein L4 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL4 cDNA ORF Clone, Mouse, C-His tag Alternative Names

2010004J23Rik cDNA ORF Clone, Mouse

RPL4 Background Information

Full Name
ribosomal protein L4

RPL4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RPL4 cDNA ORF Clone in Cloning Vector, Rhesus CG90606-G
RPL4 cDNA ORF Clone, Rhesus, untagged CG90606-UT
RPL4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90606-ACGLN
RPL4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90606-ACG
RPL4 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90606-ANG
RPL4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90606-ACR
RPL4 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90606-ANR
RPL4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90606-CF
RPL4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90606-NF
RPL4 cDNA ORF Clone, Rhesus, C-His tag CG90606-CH
RPL4 cDNA ORF Clone, Rhesus, N-His tag CG90606-NH
RPL4 cDNA ORF Clone, Rhesus, C-HA tag CG90606-CY
RPL4 cDNA ORF Clone, Rhesus, N-HA tag CG90606-NY
RPL4 cDNA ORF Clone, Rhesus, C-Myc tag CG90606-CM
RPL4 cDNA ORF Clone, Rhesus, N-Myc tag CG90606-NM

RPL4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL4 cDNA ORF Clone in Cloning Vector, Rat RG80748-U
RPL4 cDNA ORF Clone, Rat, untagged RG80748-UT
RPL4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80748-ACGLN
RPL4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80748-ACG
RPL4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80748-ANG
RPL4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80748-ACR
RPL4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80748-ANR
RPL4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80748-CF
RPL4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80748-NF
RPL4 cDNA ORF Clone, Rat, C-His tag RG80748-CH
RPL4 cDNA ORF Clone, Rat, N-His tag RG80748-NH
RPL4 cDNA ORF Clone, Rat, C-HA tag RG80748-CY
RPL4 cDNA ORF Clone, Rat, N-HA tag RG80748-NY
RPL4 cDNA ORF Clone, Rat, C-Myc tag RG80748-CM
RPL4 cDNA ORF Clone, Rat, N-Myc tag RG80748-NM
RPL4 qPCR Primer Pairs, Rat RP300712

RPL4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL4 cDNA ORF Clone in Cloning Vector, Mouse MG51706-G
RPL4 cDNA ORF Clone, Mouse, untagged MG51706-UT
RPL4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51706-ACG
RPL4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51706-ACGLN
RPL4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51706-ANG
RPL4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51706-ACR
RPL4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51706-ANR
RPL4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51706-CF
RPL4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51706-NF
RPL4 cDNA ORF Clone, Mouse, N-His tag MG51706-NH
RPL4 cDNA ORF Clone, Mouse, C-HA tag MG51706-CY
RPL4 cDNA ORF Clone, Mouse, N-HA tag MG51706-NY
RPL4 cDNA ORF Clone, Mouse, C-Myc tag MG51706-CM
RPL4 cDNA ORF Clone, Mouse, N-Myc tag MG51706-NM
RPL4 qPCR Primer Pairs, Mouse MP201579

RPL4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL4 cDNA ORF Clone in Cloning Vector, Human HG16558-U
RPL4 cDNA ORF Clone, Human, untagged HG16558-UT
RPL4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16558-ACG
RPL4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16558-ACGLN
RPL4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16558-ANG
RPL4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16558-ACR
RPL4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16558-ANR
RPL4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16558-CF
RPL4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16558-NF
RPL4 cDNA ORF Clone, Human, C-His tag HG16558-CH
RPL4 cDNA ORF Clone, Human, N-His tag HG16558-NH
RPL4 cDNA ORF Clone, Human, C-HA tag HG16558-CY
RPL4 cDNA ORF Clone, Human, N-HA tag HG16558-NY
RPL4 cDNA ORF Clone, Human, C-Myc tag HG16558-CM
RPL4 cDNA ORF Clone, Human, N-Myc tag HG16558-NM
info info
添加购物车成功! 添加购物车失败!