After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón FTLS / RSPO2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse RSPO2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_172815.3
Tamaño de cDNA:732bp
Descripción de cDNA:Full length Clone DNA of Mus musculus R-spondin 2 homolog with N terminal Flag tag.
Sinónimo de gen:ftls, AA673245
Especie:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fondo

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Referencias
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • Size / Price
    Catálogo: MG51078-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"