After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SERPINB6B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_011454.1
Tamaño de cDNA:1134bp
Descripción de cDNA:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6b with C terminal Myc tag.
Sinónimo de gen:NK13, Spi12, ovalbumin, Serpinb6b
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50371-ACG$225
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50371-ACR$225
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50371-ANG$225
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50371-ANR$225
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50371-CF$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50371-CH$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50371-CM$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50371-CY$195
Ratón Serpinb6b clonación del ADN o clonación génica(Vector de expresión)MG50371-M$75
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50371-NF$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50371-NH$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50371-NM$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50371-NY$195
Ratón Serpinb6b clonación del ADN o clonación génica(vector de clonación)MG50371-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Referencias
  • Morgenstern KA, et al. (1994) Complementary DNA cloning and kinetic characterization of a novel intracellular serine proteinase inhibitor: mechanism of action with trypsin and factor Xa as model proteinases. Biochemistry. 33(11): 3432-41.
  • Strik MC, et al. (2004) Intracellular serpin SERPINB6 (PI6) is abundantly expressed by human mast cells and forms complexes with beta-tryptase monomers. Blood.103(7): 2710-7.
  • Scott FL, et al. (2007) SerpinB6 is an inhibitor of kallikrein-8 in keratinocytes. J Biochem. 142(4): 435-42.
  • Size / Price
    Catálogo: MG50371-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"