Pedido rápido

Text Size:AAA

Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SERPINC1 Información de producto de clon de cDNA
Tamaño de cDNA:1398bp
Descripción de cDNA:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 with N terminal Flag tag.
Sinónimo de gen:At3, At-3, ATIII, AI114908
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52927-ACG$225
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52927-ACR$225
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52927-ANG$225
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52927-ANR$225
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52927-CF$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52927-CH$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52927-CM$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52927-CY$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(Vector de expresión)MG52927-G$75
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52927-NF$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52927-NH$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52927-NM$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52927-NY$195
Ratón Antithrombin III/ATIII clonación del ADN o clonación génica(vector de clonación)MG52927-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

  • de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.
  • Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.
  • Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.
  • Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.
  • Size / Price
    Catálogo: MG52927-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.