After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón SIGIRR/TIR8 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SIGIRR Información de producto de clon de cDNA
Gene_bank_ref_id:NM_023059.3
Tamaño de cDNA:1230bp
Descripción de cDNA:Full length Clone DNA of Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain with N terminal His tag.
Sinónimo de gen:TIR8, AI256711, MGC102426
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fondo

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

Referencias
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Catálogo: MG50122-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"