Pedido rápido

Ratón CRACC/SLAM7/CD319 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SLAMF7 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_144539.5
Tamaño de cDNA:1002bp
Descripción de cDNA:Full length Clone DNA of Mus musculus SLAM family member 7 with N terminal Myc tag.
Sinónimo de gen:19A, CS1, 19A24, CRACC, 4930560D03Rik, Slamf7
Especie:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón CRACC/SLAM7/CD319 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Product nameProduct name
Fondo

SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

Referencias
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • Size / Price
    Catálogo: MG50201-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"