Pedido rápido

Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón SLC25A5 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_007451.3
    Tamaño de cDNA:897bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5 with N terminal His tag.
    Sinónimo de gen:Ant2
    Especie:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SLC25A5 qPCR primers for gene expression analysis, MP201290 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51406-ACG$225
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51406-ACR$225
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51406-ANG$225
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51406-ANR$225
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51406-CF$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51406-CH$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51406-CM$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51406-CY$195
    Ratón SLC25A5 clonación del ADN o clonación génica(Vector de expresión)MG51406-G$75
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51406-NF$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51406-NH$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51406-NM$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51406-NY$195
    Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación)MG51406-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51406-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"