Pedido rápido

Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SLC25A5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_007451.3
Tamaño de cDNA:897bp
Descripción de cDNA:Full length Clone DNA of Mus musculus solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5 with N terminal His tag.
Sinónimo de gen:Ant2
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51406-ACG$225
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51406-ACR$225
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51406-ANG$225
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51406-ANR$225
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51406-CF$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51406-CH$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51406-CM$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51406-CY$195
Ratón SLC25A5 clonación del ADN o clonación génica(Vector de expresión)MG51406-G$75
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51406-NF$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51406-NH$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51406-NM$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51406-NY$195
Ratón SLC25A5 clonación del ADN o clonación génica(vector de clonación)MG51406-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51406-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"