Pedido rápido

Text Size:AAA

Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SLC35F4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_029238.2
Tamaño de cDNA:1458bp
Descripción de cDNA:Full length Clone DNA of Mus musculus solute carrier family 35, member F4 with C terminal His tag.
Sinónimo de gen:4930550L21Rik
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51720-ACG$225
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51720-ACR$225
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51720-ANG$225
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51720-ANR$225
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51720-CF$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51720-CH$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51720-CM$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51720-CY$195
Ratón SLC35F4 clonación del ADN o clonación génica(Vector de expresión)MG51720-G$75
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51720-NF$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51720-NH$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51720-NM$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51720-NY$195
Ratón SLC35F4 clonación del ADN o clonación génica(vector de clonación)MG51720-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51720-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"