Pedido rápido

Text Size:AAA

Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SLC41A1 Información de producto de clon de cDNA
Tamaño de cDNA:1539bp
Descripción de cDNA:Full length Clone DNA of Mus musculus solute carrier family 41, member 1 with N terminal His tag.
Sinónimo de gen:AI573938; B230315F01Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52545-ACG$245
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52545-ACR$245
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52545-ANG$245
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52545-ANR$245
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52545-CF$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52545-CH$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52545-CM$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52545-CY$215
Mouse SLC41A1 Gene cDNA clone plasmidMG52545-G$75
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52545-NF$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52545-NH$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52545-NM$215
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52545-NY$215
Ratón SLC41A1 clonación del ADN o clonación génica(Vector de expresión)MG52545-U$75
Ratón SLC41A1 clonación del ADN o clonación génica(vector de clonación)MG52545-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52545-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.