SLC9A3R2 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

SLC9A3R2 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Mouse solute carrier family 9 (sodium>hydrogen exchanger), member 3 regulator 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLC9A3R2 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

0610011L07Rik cDNA ORF Clone, Mouse; 1200011K07Rik cDNA ORF Clone, Mouse; 2010007A20Rik cDNA ORF Clone, Mouse; E3karp cDNA ORF Clone, Mouse; NHERF-2 cDNA ORF Clone, Mouse; Nherf2 cDNA ORF Clone, Mouse; Octs2 cDNA ORF Clone, Mouse; Sip-1 cDNA ORF Clone, Mouse; Sip1 cDNA ORF Clone, Mouse; Sryip1 cDNA ORF Clone, Mouse; Tka-1 cDNA ORF Clone, Mouse

SLC9A3R2 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait