SLIT2 cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

SLIT2 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
4566 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 819 C/T, 1512 T/C, 1716 C/T, 2217 T/C and 3610 A/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse slit homolog 2 (Drosophila) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 4.62kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLIT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLIT2 cDNA ORF Clone, Mouse, C-His tag: Validated Images

SLIT2 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

Drad-1 cDNA ORF Clone, Mouse; E030015M03Rik cDNA ORF Clone, Mouse; E130320P19Rik cDNA ORF Clone, Mouse; mKIAA4141 cDNA ORF Clone, Mouse; Slil3 cDNA ORF Clone, Mouse; slit-2 cDNA ORF Clone, Mouse

SLIT2 Background Information

Add to Cart Successfully Add to Cart Failed