After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón OPN/Osteopontin clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SPP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009263.2
Tamaño de cDNA:885bp
Descripción de cDNA:Full length Clone DNA of Mus musculus secreted phosphoprotein 1 with N terminal His tag.
Sinónimo de gen:OP, Bsp, Eta, Opn, Ric, BNSP, BSPI, Opnl, Apl-1, ETA-1, Spp-1, AA960535, AI790405, minopontin
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón OPN/Osteopontin clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name
Fondo

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

Referencias
  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Catálogo: MG50116-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"