After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SRFBP1 Información de producto de clon de cDNA
Tamaño de cDNA:1326bp
Descripción de cDNA:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Flag tag.
Sinónimo de gen:p49/STRAP, 2810036K01Rik
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51646-ACG$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51646-ACR$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51646-ANG$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51646-ANR$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51646-CF$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51646-CH$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51646-CM$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51646-CY$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(Vector de expresión)MG51646-G$75
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51646-NF$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51646-NH$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51646-NM$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51646-NY$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación)MG51646-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Catálogo: MG51646-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.