Pedido rápido

Text Size:AAA

Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón SRFBP1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_026040.3
    Tamaño de cDNA:1326bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Flag tag.
    Sinónimo de gen:p49/STRAP, 2810036K01Rik
    Especie:Mouse
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SRFBP1 qPCR primers for gene expression analysis, MP201519 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51646-ACG$225
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51646-ACR$225
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51646-ANG$225
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51646-ANR$225
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51646-CF$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51646-CH$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51646-CM$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51646-CY$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(Vector de expresión)MG51646-G$75
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51646-NF$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51646-NH$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51646-NM$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51646-NY$195
    Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación)MG51646-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

    Referencias
  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Catálogo: MG51646-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"