Pedido rápido

Text Size:AAA

Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SRFBP1 Información de producto de clon de cDNA
Tamaño de cDNA:1326bp
Descripción de cDNA:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Myc tag.
Sinónimo de gen:p49/STRAP, 2810036K01Rik
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51646-ACG$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51646-ACR$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51646-ANG$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51646-ANR$225
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51646-CF$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51646-CH$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51646-CM$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51646-CY$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(Vector de expresión)MG51646-G$75
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51646-NF$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51646-NH$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51646-NM$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51646-NY$195
Ratón SRFBP1 (p49/STRAP) clonación del ADN o clonación génica(vector de clonación)MG51646-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Catálogo: MG51646-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.