Pedido rápido

Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón STAT5A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_011488.3
    Tamaño de cDNA:2382bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus signal transducer and activator of transcription 5A with C terminal HA tag.
    Sinónimo de gen:STAT5, AA959963, Stat5a
    Especie:Mouse
    Vector:pCMV3-C-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with STAT5a qPCR primers for gene expression analysis, MP201068 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51117-ACG$245
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51117-ACR$245
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51117-ANG$245
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51117-ANR$245
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51117-CF$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51117-CH$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51117-CM$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51117-CY$215
    Ratón STAT5a clonación del ADN o clonación génica(Vector de expresión)MG51117-G$75
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51117-NF$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51117-NH$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51117-NM$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51117-NY$215
    Ratón STAT5a clonación del ADN o clonación génica(vector de clonación)MG51117-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51117-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"