Smad3 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Smad3 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse MAD homolog 3 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.28kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Smad3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad3 cDNA ORF Clone, Mouse, untagged: Alternative Names

AU022421 cDNA ORF Clone, Mouse; Madh3 cDNA ORF Clone, Mouse

Smad3 Background Information

SMAD3 belongs to the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD3 is involved in cell signalling. It modulates signals of activin and TGFβ's. Binding of SMAD3 with SMAD4 enables its transmigration into the nucleus where it forms complexes with other proteins and acts as a transcription factor. SMAD3 is a receptor-regulated SMAD (R-SMAD). In mice, mutation of SMAD3 has been linked to colorectal adenocarcinoma, increased systemic inflammation, and accelerated wound healing. Increased SMAD3 activity has been implicated in the pathogenesis of scleroderma. Smad3 is also a multifaceted regulator in adipose physiology and the pathogenesis of obesity and type 2 diabetes.
Full Name
SMAD family member 3
References
  • Tan. et al., 2011, Diabetes. 60 (2): 464-76.
  • Yang X. et al., 1999, Nat Cell Biol. 1 (5): 260-6.
  • Zhu Y. et al., 1998, Cell. 94 (6): 703-14.
  • Feng X. et al., 1996, Nature. 383 (6596): 168-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait