After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse SMAD5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_008541.3
Tamaño de cDNA:1398bp
Descripción de cDNA:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 5 with N terminal His tag.
Sinónimo de gen:Madh5, Msmad5
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50728-ACG$225
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50728-ACR$225
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50728-ANG$225
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50728-ANR$225
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50728-CF$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50728-CH$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50728-CM$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50728-CY$195
Ratón Smad5 clonación del ADN o clonación génica(Vector de expresión)MG50728-G$75
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50728-G-Y$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50728-NF$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50728-NH$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50728-NM$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50728-NY$195
Ratón Smad5 clonación del ADN o clonación génica(vector de clonación)MG50728-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

Referencias
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Catálogo: MG50728-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"