Pedido rápido

Text Size:AAA

Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TBC1D17 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001042655.1
Tamaño de cDNA:1938bp
Descripción de cDNA:Full length Clone DNA of Mus musculus TBC1 domain family, member 17 with C terminal His tag.
Sinónimo de gen:BC017607
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51707-ACG$245
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51707-ACR$245
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51707-ANG$245
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51707-ANR$245
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51707-CF$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51707-CH$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51707-CM$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51707-CY$215
Mouse TBC1D17 Gene cDNA clone plasmidMG51707-G$75
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51707-NF$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51707-NH$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51707-NM$215
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51707-NY$215
Ratón TBC1D17 clonación del ADN o clonación génica(Vector de expresión)MG51707-U$75
Ratón TBC1D17 clonación del ADN o clonación génica(vector de clonación)MG51707-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51707-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"