Pedido rápido

Text Size:AAA

Ratón Tie2/CD202b/TEK clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TEK Información de producto de clon de cDNA
Tamaño de cDNA:3372bp
Descripción de cDNA:Full length Clone DNA of Mus musculus endothelial-specific receptor tyrosine kinase with C terminal His tag.
Sinónimo de gen:Hyk, Tie2, tie-2, Cd202b, AA51
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón Tie2/CD202b/TEK clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.

  • Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.
  • Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.
  • Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.
  • Size / Price
    Catálogo: MG51087-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.