Pedido rápido

Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TFRC Información de producto de clon de cDNA
Gene_bank_ref_id:NM_011638.4
Tamaño de cDNA:2292bp
Descripción de cDNA:Full length Clone DNA of Mus musculus transferrin receptor with N terminal His tag.
Sinónimo de gen:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50741-ACG$245
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50741-ACR$245
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50741-ANG$245
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50741-ANR$245
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50741-CF$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50741-CH$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50741-CM$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50741-CY$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(Vector de expresión)MG50741-G$75
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50741-NF$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50741-NH$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50741-NM$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50741-NY$215
Ratón TFRC/CD71 clonación del ADN o clonación génica(vector de clonación)MG50741-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

Referencias
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Catálogo: MG50741-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"