After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TMEM186 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_025708.4
Tamaño de cDNA:651bp
Descripción de cDNA:Full length Clone DNA of Mus musculus transmembrane protein 186 with C terminal His tag.
Sinónimo de gen:AI648175, AW210586, 2810440M13Rik, 4432406C05Rik
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52286-ACG$225
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52286-ACR$225
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52286-ANG$225
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52286-ANR$225
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52286-CF$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52286-CH$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52286-CM$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52286-CY$195
Ratón TMEM186 clonación del ADN o clonación génica(Vector de expresión)MG52286-G$75
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52286-NF$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52286-NH$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52286-NM$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52286-NY$195
Ratón TMEM186 clonación del ADN o clonación génica(vector de clonación)MG52286-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52286-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"