After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón TMEM27 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TMEM27 Información de producto de clon de cDNA
Tamaño de cDNA:669bp
Descripción de cDNA:Full length Clone DNA of Mus musculus transmembrane protein 27 with N terminal HA tag.
Sinónimo de gen:NX17, NX-17, NX=17, collectrin, 0610008J07Rik, Tmem27
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • Size / Price
    Catálogo: MG50547-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.