After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TNFRSF10B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_020275.4
Tamaño de cDNA:1146bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 10b with C terminal Flag tag.
Sinónimo de gen:MK, DR5, Ly98, KILLER, TRICKB, TRAILR2, TRICK2A, TRICK2B, Tnfrsf10b
Especie:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50412-ACG$225
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50412-ACR$225
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50412-CF$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50412-CH$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50412-CM$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50412-CY$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(Vector de expresión)MG50412-G$75
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50412-NF$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50412-NH$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50412-NM$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50412-NY$195
Ratón TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación)MG50412-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

Referencias
  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Catálogo: MG50412-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"