Pedido rápido

Ratón TACI/TNFRSF13B(CD267) clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
Hoja de datosReseñasProductos relacionadosProtocolos
Ratón TNFRSF13B Información de producto de clon de cDNA
Tamaño de cDNA:750bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 13b with N terminal His tag.
Sinónimo de gen:Taci, 1200009E08Rik
Sitio de restricción:KpnI + XbaI (6kb + 0.84kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
( We provide with TNFRSF13B qPCR primers for gene expression analysis, MP200160 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón TNFRSF13B Gene Plasmid Map
Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón TACI/TNFRSF13B(CD267) clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.

  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.
  • Size / Price
    Catálogo: MG50130-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.