After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TPP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009906.5
Tamaño de cDNA:1689bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tripeptidyl peptidase I with N terminal HA tag.
Sinónimo de gen:Cln2; TPP-I
Especie:Mouse
Vector:pCMV3-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52010-ACG$245
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52010-ACR$245
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52010-ANG$245
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52010-ANR$245
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52010-CF$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52010-CH$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52010-CM$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52010-CY$215
Mouse TPP1 Gene cDNA clone plasmidMG52010-G$195
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52010-NF$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52010-NH$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52010-NM$215
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52010-NY$215
Ratón CLN2 clonación del ADN o clonación génica(Vector de expresión)MG52010-U$75
Ratón CLN2 clonación del ADN o clonación génica(vector de clonación)MG52010-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

Referencias
  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • Size / Price
    Catálogo: MG52010-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"