Pedido rápido

Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TPT1 Información de producto de clon de cDNA
Tamaño de cDNA:519 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tumor protein, translationally-controlled 1
Sinónimo de gen:p21,p23,TCTP,Trt
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51648-ACG$225
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51648-ACR$225
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51648-ANG$225
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51648-ANR$225
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51648-CF$75
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51648-CH$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51648-CM$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51648-CY$195
Mouse TPT1 Gene cDNA clone plasmidMG51648-G$75
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51648-NF$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51648-NH$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51648-NM$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51648-NY$195
Ratón TCTP /TPT1 clonación del ADN o clonación génica(Vector de expresión)MG51648-U$75
Ratón TCTP /TPT1 clonación del ADN o clonación génica(vector de clonación)MG51648-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Tumor protein, also known as TPT1, is a highly conserved protein among many eukaryotic organisms. Tumor protein is involved in a variety of cellular activities, including microtubule stabilization, calcium-binding activities, and apoptosis. The Mammalian translationally controlled tumour protein (TPT1) (or P23) is a protein which has been found to be preferentially synthesised in cells during the early growth phase of some types of tumour, but which is also expressed in normal cells. It was first identified as a histamine-releasing factor, acting in IgE +-dependent allergic reactions. In addition, TPT1 has been shown to bind to tubulin in the cytoskeleton, has a high affinity for calcium, is the binding target for the antimalarial compound artemisinin, and is induced in vitamin D-dependent apoptosis. TPT1 production is thought to be controlled at the translational as well as the transcriptional level.

  • Thaw P. et al., 2001, Nat Struct Biol. 8 (8): 701-4.
  • Thiele H. et al., 2000, Eur J Biochem. 267 (17): 5473-81.
  • Chitpatima ST. et al., 1988, Nucleic Acids Res. 16 (5): 2350.
  • Size / Price
    Catálogo: MG51648-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.