After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse TTLL12 Información de producto de clon de cDNA
Tamaño de cDNA:1920bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tubulin tyrosine ligase-like family, member 12 with N terminal His tag.
Sinónimo de gen:BC055368, D430005B17
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52814-ACG$245
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52814-ACR$245
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52814-ANG$245
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52814-ANR$245
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52814-CF$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52814-CH$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52814-CM$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52814-CY$215
Ratón TTLL12 clonación del ADN o clonación génica(Vector de expresión)MG52814-G$75
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52814-NF$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52814-NH$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52814-NM$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52814-NY$215
Ratón TTLL12 clonación del ADN o clonación génica(vector de clonación)MG52814-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52814-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.