Pedido rápido

Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse NTRK2 Información de producto de clon de cDNA
Tamaño de cDNA:2466bp
Descripción de cDNA:Full length Clone DNA of Mus musculus neurotrophic tyrosine kinase, receptor, type 2, transcript variant 1 with N terminal His tag.
Sinónimo de gen:Tkrb, trkB, AI848316, C030027L06Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50132-ACG$245
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50132-ACR$245
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50132-CF$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50132-CH$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50132-CM$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50132-CY$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)MG50132-M$75
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50132-NF$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50132-NH$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50132-NM$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50132-NY$215
Ratón TrkB/NTRK2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)MG50132-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Size / Price
    Catálogo: MG50132-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.