Pedido rápido

Ratón USP5 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón USP5 Información de producto de clon de cDNA
    Gene_bank_ref_id:AK154008.1
    Tamaño de cDNA:2508bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus ubiquitin specific peptidase 5 (isopeptidase T).
    Sinónimo de gen:ISOT, Ucht, ISOT-1, AA407472
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with USP5 qPCR primers for gene expression analysis, MP201244 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón USP5 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Product nameProduct name
    Fondo

    Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.

    Referencias
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catálogo: MG51371-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"