Pedido rápido

Ratón VAT1L clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón VAT1L Información de producto de clon de cDNA
Tamaño de cDNA:1254bp
Descripción de cDNA:Full length Clone DNA of Mus musculus vesicle amine transport protein 1 homolog-like (T. californica) with C terminal His tag.
Sinónimo de gen:AI427515, mKIAA1576, 9430073I07
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
( We provide with VAT1L qPCR primers for gene expression analysis, MP202169 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón VAT1L clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: MG52296-CH
Precio de lista: 
Precio:      (You Save: )
Añadir a carroBulk Discount Requiry
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.