After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse VCP Información de producto de clon de cDNA
Tamaño de cDNA:2421bp
Descripción de cDNA:Full length Clone DNA of Mus musculus valosin containing protein with N terminal Myc tag.
Sinónimo de gen:p97; CDC48; p97/VCP; 3110001E05
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52034-ACG$245
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52034-ACR$245
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52034-ANG$245
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52034-ANR$245
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52034-CF$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52034-CH$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52034-CM$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52034-CY$215
Mouse VCP Gene cDNA clone plasmidMG52034-G$75
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52034-NF$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52034-NH$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52034-NM$215
Ratón VCP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52034-NY$215
Ratón VCP clonación del ADN o clonación génica(Vector de expresión)MG52034-U$75
Ratón VCP clonación del ADN o clonación génica(vector de clonación)MG52034-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52034-NM
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.