Pedido rápido

Ratón VGF clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

  • Mouse VGF natural ORF mammalian expression plasmid, C-His tag
Hoja de datosReseñasProductos relacionadosProtocolos
Ratón VGF Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001039385.1
Tamaño de cDNA:1854bp
Descripción de cDNA:Full length Clone DNA of Mus musculus VGF nerve growth factor inducible with C terminal His tag.
Sinónimo de gen:Gm1052
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:pCMV3-mVGF-His
Sitio de restricción:KpnI + XbaI (6kb + 1.90kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with VGF qPCR primers for gene expression analysis, MP201590 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón VGF Gene Plasmid Map
Mouse VGF natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"