Pedido rápido

Ratón VPS53 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón VPS53 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_026664.3
Tamaño de cDNA:2499bp
Descripción de cDNA:Full length Clone DNA of Mus musculus vacuolar protein sorting 53 (yeast).
Sinónimo de gen:Hccs1, 2010002A08Rik, 2310040I21Rik, 3100002B05Rik
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with VPS53 qPCR primers for gene expression analysis, MP201218 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: MG51341-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"