Pedido rápido

Text Size:AAA

Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse WARS2 Información de producto de clon de cDNA
Tamaño de cDNA:1083 bp
Descripción de cDNA:Full length Clone DNA of Mus musculus tryptophanyl tRNA synthetase 2 (mitochondrial)
Sinónimo de gen:5730427B17Rik,9430020O07Rik,AI413375,TrpRS
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG53037-ACG$225
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG53037-ACR$225
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG53037-ANG$225
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG53037-ANR$225
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG53037-CF$75
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG53037-CH$195
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG53037-CM$195
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG53037-CY$195
Mouse WARS2 Gene cDNA clone plasmidMG53037-G$75
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG53037-NF$195
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG53037-NH$195
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG53037-NM$195
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG53037-NY$195
Ratón WARS2 clonación del ADN o clonación génica(Vector de expresión)MG53037-U$75
Ratón WARS2 clonación del ADN o clonación génica(vector de clonación)MG53037-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG53037-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.