Pedido rápido

Text Size:AAA

Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ZUFSP Información de producto de clon de cDNA
Tamaño de cDNA:1734bp
Descripción de cDNA:Full length Clone DNA of Mus musculus zinc finger with UFM1-specific peptidase domain with C terminal His tag.
Sinónimo de gen:2700019D07Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51712-ACG$345
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51712-ACR$345
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51712-ANG$345
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51712-ANR$345
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51712-CF$215
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51712-CH$315
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51712-CM$315
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51712-CY$315
Mouse ZUFSP Gene cDNA clone plasmidMG51712-G$75
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51712-NF$315
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51712-NH$315
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51712-NM$315
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51712-NY$315
Ratón ZUFSP clonación del ADN o clonación génica(Vector de expresión)MG51712-U$75
Ratón ZUFSP clonación del ADN o clonación génica(vector de clonación)MG51712-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51712-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.