Pedido rápido

Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human PPP2CA Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref.ID sequence.
Human PPP2CA Gene Plasmid Map
Human PPP2CA Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10420-ACG$225
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10420-ACR$225
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10420-ANG$225
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10420-ANR$225
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10420-CF$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10420-CH$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10420-CM$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10420-CY$195
Humano PPP2CA clonación del ADN o clonación génica(Vector de expresión)HG10420-M$75
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10420-NF$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10420-NH$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10420-NM$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10420-NY$195
Humano PPP2CA clonación del ADN o clonación génica(vector de clonación)HG10420-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Contact Us
  • Human PPP2CA Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.