Pedido rápido

Hoja de datosReseñasProductos relacionadosProtocolos
Human PRMT5 Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Human PRMT5 Gene Plasmid Map
Human PRMT5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11074-ACG$245
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11074-ACR$245
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11074-ANG$245
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11074-ANR$245
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11074-CF$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11074-CH$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11074-CM$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11074-CY$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(Vector de expresión)HG11074-M$75
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11074-NF$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11074-NH$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11074-NM$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11074-NY$215
Humano PRMT5/SKB1 clonación del ADN o clonación génica(vector de clonación)HG11074-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Contact Us
    • Human PRMT5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.