HIGD1A cDNA ORF Clone, Rabbit, C-Myc tag

Price:
Size:
Number:

HIGD1A cDNA ORF Clone, Rabbit, C-Myc tag: General Information

Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Rabbit HIG1 domain family, member 1A-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HIGD1A Background Information

Full Name
HIG1 hypoxia inducible domain family, member 1A

HIGD1A cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait