Aconitase 2 cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

Aconitase 2 cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Rat aconitase 2, mitochondrial with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aconitase 2 Background Information

A homozygous missense mutation was identified in the ACO2 gene (c.124T>G p.Phe414Val) that segregated with HSP complicated by intellectual disability and microcephaly. Lymphoblastoid cell lines of homozygous carrier patients revealed significantly decreased activity of the mitochondrial aconitase enzyme and defective mitochondrial respiration. ACO2 encodes mitochondrial aconitase, an essential enzyme in the Krebs cycle. Recessive mutations in this gene have been previously associated with cerebellar ataxia. We found homozygous or compound heterozygous missense and frameshift mutations in the gene encoding mitochondrial aconitase (ACO2), a tricarboxylic acid cycle enzyme, catalysing interconversion of citrate into isocitrate. Unlike wild type ACO2, all mutant ACO2 proteins failed to complement the respiratory growth of a yeast aco1-deletion strain. The study shows that autosomal recessive ACO2 mutations can cause either isolated or syndromic optic neuropathy. This observation identifies ACO2 as the second gene responsible for non-syndromic autosomal recessive optic neuropathies and provides evidence for a genetic overlap between isolated and syndromic forms, giving further support to the view that optic atrophy is a hallmark of defective mitochondrial energy supply.
Full Name
aconitase 2, mitochondrial
References
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait