After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat AGA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001031641.1
Tamaño de cDNA:1038bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus aspartylglucosaminidase with N terminal Flag tag.
Sinónimo de gen:Aga
Especie:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81623-ACG$225
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81623-ACR$225
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81623-CF$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81623-CH$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81623-CM$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81623-CY$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(Vector de expresión)RG81623-G$75
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81623-NF$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81623-NH$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81623-NM$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81623-NY$195
Rat ASRG / Aspartylglucosaminidase clonación del ADN o clonación génica(vector de clonación)RG81623-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.

Human Protein S100-A8, also known as S100 calcium-binding protein A8, Cystic fibrosis antigen, Migration inhibitory factor-related protein 8, S100A8, and CAGA, is a member of the S-100 family. S100A8 plays a role in various functions of myeloid cells by forming a heterocomplex with S100A9. S100A8 and S100A9 are known to be overexpressed in certain species of carcinomas. S100A8 plays an important role in dedifferentiation of thyroid carcinoma possibly by forming a complex with S100A9. S100A8 and S100A9 may also play a key role in inflammation-associated cancer.

Referencias
  • Donato, R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Gebhardt, C. et al., 2006,  Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Size / Price
    Catálogo: RG81623-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"