After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat APEX1 Información de producto de clon de cDNA
Tamaño de cDNA:954bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus APEX nuclease (multifunctional DNA repair enzyme) 1 with N terminal Myc tag.
Sinónimo de gen:APE, Apex, REF-1
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80756-ACG$225
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80756-ACR$225
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80756-ANG$225
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80756-ANR$225
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80756-CF$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80756-CH$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80756-CM$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80756-CY$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80756-NF$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80756-NH$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80756-NM$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80756-NY$195
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(Vector de expresión)RG80756-U$75
Rat APEX1/APE1/Ref-1 clonación del ADN o clonación génica(vector de clonación)RG80756-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Catálogo: RG80756-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.