ATP5A1 cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

ATP5A1 cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1662 bp
Description
Full length Clone DNA of Rat ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATP5A1 Background Information

Full Name
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

ATP5A1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait