After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat CD157/BST1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat BST1 Información de producto de clon de cDNA
Tamaño de cDNA:960bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus bone marrow stromal cell antigen 1 with C terminal HA tag.
Sinónimo de gen:Bst1
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD157, also known as ADP-ribosyl cyclase 2, is an ectoenzyme sharing several characteristics with ADP-ribosyl cyclase CD38. CD157 was originally identified as a bone marrow stromal cell molecule (BST-1) with a glycosylphosphatidylinositol (GPI) anchor to bind to the cell surface. CD157 is prevalently expressed by cells of the myeloid lineage. CD157 could act as a receptor with signal transduction capability. Further, it regulates calcium homeostasis and promotes polarization in neutrophils and mediates superoxide (O2−) production in the human U937 myeloid line.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Malavasi F, et al. (2006) CD38 and CD157 as Receptors of the Immune System: A Bridge Between Innate and Adaptive Immunity. Molecular Medicine. 12 (11-12): 334-41.
  • Ortolan E, et al. (2002) CD157, the janus of CD38 but with a unique personality. Cell Biochemistry and Function. 20 (4): 309-22.
  • Size / Price
    Catálogo: RG80351-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.