Pedido rápido

Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat C5AR1 Información de producto de clon de cDNA
Tamaño de cDNA:1059bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus complement component 5a receptor 1 with N terminal His tag.
Sinónimo de gen:C5r1, C5ar1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80336-ACG$225
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80336-ACR$225
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80336-CF$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80336-CH$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80336-CM$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80336-CY$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(Vector de expresión)RG80336-G$75
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80336-NF$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80336-NH$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80336-NM$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80336-NY$195
Rat C5a anaphylatoxin receptor 1 clonación del ADN o clonación génica(vector de clonación)RG80336-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG80336-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.