Pedido rápido

Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CAPN6 Información de producto de clon de cDNA
Tamaño de cDNA:1926bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus calpain 6 with C terminal His tag.
Sinónimo de gen:Capn6
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81040-ACG$245
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81040-ACR$245
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81040-ANG$245
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81040-ANR$245
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81040-CF$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81040-CH$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81040-CM$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81040-CY$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81040-NF$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81040-NH$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81040-NM$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81040-NY$215
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(Vector de expresión)RG81040-U$75
Rat Calpain 6/CAPN6 clonación del ADN o clonación génica(vector de clonación)RG81040-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG81040-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.