Pedido rápido

Text Size:AAA

Rat CD28/TP44 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD28 Información de producto de clon de cDNA
Tamaño de cDNA:657bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd28 molecule with C terminal His tag.
Sinónimo de gen:CD28RNA, Cd28
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • Size / Price
    Catálogo: RG80302-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.